Alignment represention:
-> The line labled 'iso' is the isostericity base-pair indication. A Star '*' represents the matched location in the seqeunce is a of part a matched isosteric base-pair.A plus symbol '+' represents the matched location is a part of matched non-isosteric base-pair.
-> The line labeled 'edge' is the interacting edges. 'W' is for Watson-Crick, 'H' is for Hoogsteen, and 'S' is for sugar edge.Upper case letters are for 'cis' orientation base-pairs while lower case letters are for 'trans' orientation base-pairs.
-> The line labeled 'struc' represents the base-pair locations. A pair of '(' and ')' represent the base-pair that was identified in the first stage,while '<' and '>' represent the base-pair that was identified in the second stage.
-> A dot in the sequence represents the breakage location of the original sequence due to presentation of multiple strands in the query motif.An '-' symbol represents a gap in the sequence.
---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------


Alignment Score: 18.600


Aligning:
Query:	1VX6_A:3012-3020
Target:	4QCN_A:2316-2324

iso	....*.*..
edge	....s.h..
struc	....(.)..

iso	....*..*.
edge	....W..H.
struc	....(..).

	AACAGAAAU
	 || *|**|
	GACGGAAAU

struc	....(..).
edge	....W..H.
iso	....*..*.

struc	....(.)..
edge	....s.h..
iso	....*.*..



Alignment Score: 17.600


Aligning:
Query:	1VX6_A:3012-3020
Target:	1VW3_A:2454-2462

iso	....*.*..
edge	....s.h..
struc	....(.)..

iso	....*..*.
edge	....W..H.
struc	....(..).

	AACAGAAAU
	 |  *|** 
	UAAGGAAAA

struc	....(..).
edge	....W..H.
iso	....*..*.

struc	....(.)..
edge	....s.h..
iso	....*.*..



Alignment Score: 11.600


Aligning:
Query:	1VX6_A:3012-3020
Target:	3J7Y_A:2385-2407

iso	...............*.*.....
edge	...............s.h.....
struc	...............(.).....

iso	...............+..+....
edge	...............W..H....
struc	...............(..)....

	---------AAC--AGAAAU---
	         |||  |+|++|   
	UCUACAAUCAACCAACAAGUCAU

struc	...............(..)....
edge	...............W..W....
iso	...............+..+....

struc	...............(.).....
edge	...............s.h.....
iso	...............*.*.....