Pre-mature Stem-loop:
aaagaucc    acaa       gcuu      uc           c        ucuca 
        ucag    uccaugu    cucuug  cuucauuccac ggagucug     u
        ||||    |||||||    ||||||  ||||||||||| ||||||||     a
        aguc    agguacg    gaggac  gaagugaggug cuuuagac     c
------ac    ---g       ----      uu           a        caacc 

Mature sequence:
5'------------------>3'
uccuucauuccaccggagucug

Below are the top 200 potential targets of microRNA: hsa-miR-205 sorted by the total sum of context scores over multiple species and multiple sites, where context scores are computed by targetscan-5.0. We also compared ranks of target genes with ranks sorted by the sum of context scores only in Human.