Pre-mature Stem-loop:
     cg    -gua       uca    c        -  g 
gugcu  guuu    ggcagug   uuag ugauugua cu u
|||||  ||||    |||||||   |||| |||||||| || g
cacgg  caaa    ccgucac   aauc acuaacau gg g
     aa    acua       cuc    -        u  u 
Mature sequence:
5'------------------>3'
caaucacuaacuccacugccau

Below are the top 200 potential targets of microRNA: hsa-miR-34b sorted by the total sum of context scores over multiple species and multiple sites, where context scores are computed by targetscan-5.0. We also compared ranks of target genes with ranks sorted by the sum of context scores only in Human.