Pre-mature Stem-loop:
c  -    a      ccu  c     c  gac 
 cc cgcg cgagcc   cg acaaa cg   c
 || |||| ||||||   || ||||| ||    
 gg gugc gcucgg   gc uguuu gc   u
c  a    -      cuu  u     u  gag 

Mature sequence:
5'------------------>3'
uuuguucguucggcucgcguga

Below are the top 200 potential targets of microRNA: hsa-miR-375 sorted by the total sum of context scores over multiple species and multiple sites, where context scores are computed by targetscan-5.0. We also compared ranks of target genes with ranks sorted by the sum of context scores only in Human.